come to HK! please come! i hear that the 5-star hotels in HK are now at single digit % occupancies, with some in single-digit room occupancies! how sad is that?

derek told me i GOTTA watch this honda accord commercial... so i watch, and dude - this was good! apparantly it took 606 takes before it was finally right! it's a continuous 2 minute shot, with no tricks or camera work, no cg or anything like that! it cool... and you gotta check it out!





just read that the next 2 matrix will be on IMAX! they better get an imax theater in HK soon!

nuthin much doing today... just chillin at home, trying to figure what's going on with the world. i think we've established that the war in iraq is over, there's some funny biz going on in n.korea (and beijing), and sars is still alive and well, unfortunately. so, what does this mean? well - for one thing, i'm wondering if it means that there's gonna be plenty of tix available for the X2 opening next week! gotta be looking forward to that, despite the fact that X1 was mediocre at best.

bye bye beijing? m'boys in da erlizhuang...
as the problems in beijing mount, my friends from the wle program (the mandarin program i took last nov-jan) are starting to bail. they're planning to move the party to either korea (south i hope!) or adelaide... well... being as how adelaide's got all of 500 people, i guess it's off to korea! plus - u know - they say that kimchi helps to prevent sars! it's the garlic....

5 more dead today... *sigh*... they say yesterday a 28 year old man died yesterday (incidently he lives at the amoy gardens, one of the most infected housing blocks). that's 121 in total for HK.... *double sigh*.... i actually went to karaoke with my friend a few nites ago, and well - i'm still here no, eh? it was a bit sketchy at first, but u know, once the mic's in hand, the bass is pumpin, the fruits on the table, and frank is in the background (sinatra)... the problems just seem to fade away... btw, i just gotta say that linda is the queen of sap; i mean, carpenters??????????

kg over shaq

who wulda thot minn would take game 3 at la! wow... what a finish - despite questionable calls for the lakes down the stretch. but they came thru, and now everyone is wondering what will happen of the 'wolves. hmmmm... i tink the lakes in 6, but they'll be getting tired for san antonio in the next, and if they go on, the kings in the west finals... now that's a worthy 3, but somehow, this ain't their year. i'll take sac to win it all this year... btw - i wonder who the tuna's gonna take for my 'boys w/the 5th pick?

this is very exciting stuff... they actually decoded the dna of the sars virus.. canada's genome sciences center did it - hey - them canucks are good for something after all... worthy to be the 51st state!!!!! heheeh here's a sample of the download:

CTACCCAGGAAAAGCCAACCAACCTCGATCTCTTGTAGATCTGTTCTCTA
AACGAACTTTAAAATCTGTGTAGCTGTCGCTCGGCTGCATGCCTAGTGCA
CCTACGCAGTATAAACAATAATAAATTTTACTGTCGTTGACAAGAAACGA
GTAACTCGTCCCTCTTCTGCAGACTGCTTACGGTTTCGTCCGTGTTGCAG
TCGATCATCAGCATACCTAGGTTTCGTCCGGGTGTGACCGAAAGGTAAGA

i dunno... i only see blonde, brunette, silky straight black tied up in a bun, a new 983k titleist driver... let's play a game... what words can u make out of these letters? tag, gat (an actual word), at, cat... gattaca? hehe now u know where the movie name came from. anyway - amazing how they can make sense of this; the whole string looks like the matrix. so - anyone remember mgmt274a - that was biotech for u forgetful fools... get on it n figure out the cure! that means YOU, kwon...

today i was chatting with my friend ho (yes.. his name is HO)... in times like these, recession, deflation, 'crisis', or whatever you wish to term it, i think we are 2 contrarians stuck amidst a wave of momentum driven sentiment. from an investment standpoint, this is great stuff - i mean, look how cheap asset prices are in corea??? go mr. roh (notice the rhymn)! - keep up w/u'r myopic banter and drive down markets to even further cheaper prices (oh wait, roh flaming was yesterday). from a personal standpoint - it's hard for a thinker to accept what is. just when things are seemingly going good, the contrarian kicks in. the cynic comes out and scrutinizes all, and soon nuthing seems right. something so difficult to contain, yet it is this very mechanism that safeguards us from the taking of yet another bite out of the forbidden fruit from the tree of life. i can't help but wonder where that will lead in the long run.. but hey - it makes for a more interesting and fun life. what that all means - i really don't know - but it just sounded good in my head. what i'm trying to say is that we are similar in that we will play the devil's advocate to the pain (to the pain!! in my best british drawl) - never once accepting that the red fire engine is red. and that.... is the root of our troubles... *sigh*....

you knew it had to happen... so - another 4 dead in HK, bringing the total to 109. another 30 ill brings that total to 1488. i'm sorry - but every nite at 7:45 - some yutz (yes, i said yutz) comes on and gives this number like the freakin mark 6 lotto. he's all smiles and happily reads the idiot cards in front of him "and YES, we have another 4 dead from sars!"...


so funny - went to see this manulife guy today - and at the end of the meeting, i motion to shake his hand, and he looks at me like i'm some kinda freak (ok... that is NOT open to comments). anyway - he very reluctantly shook my hand. then after, he tells me 'we don't do that in hk anymore'.... apparantly, handshaking has become taboo! then, he suggests i quickly go wash my hands! i was somewhat surprised that this is what has become of the hongkies, but at the same time, it was pretty amusing. then he says... "i'm serious"... as if i didn't believe he was a freak the first time around...

your worst nitemare??

funny thing today... was at this mall in mongkok, and as i'm walk outside this one restaurant, sweet basil, i hear all this screaming. for those of u that don't know, sweet basil is sorta open air to the rest of the mall - with like this wooden lattice work of a 'window' peering into the restaurant. at first i thot maybe it was a party w/some clown running around squirting spermicide mousse on people's tables. but then, as i walked closer to the 'window', i just heard a wave of eeeeeeeeeeekkkkkk aaaaiiiiyyaaahhh flow thru the restaurant, much like 'the wave' is done in stadiums, but w/voices in this case. anyway... moving closer to the entrance and peering in, i see this HUGE tail moving inbetween tables n chairs. then i see all these men in red running round the restaurant with these plastic tubs. it was one of the funniest things... half the restaurant made a quick exit, and in the middle of their meals, i gather (I wonder if they went back). but anyway, the wily rat made 2 circles around the restaurant before finally getting caught near the front entrance. well - being as some health peoples have linked sars to rats, i wonder... hmmmmmmmmmmm

well... we well into round 1 of the nba playoffs... lakes just took a beating by the wolves, and unfortunately, the nets lost to the bucks. boy - this sounds like the commentating given by the awesome star sports commentators. tonite at 2:30 am is man u vs. real madrid in the 2nd leg of their qfinal uefa champs match. this is gonna be good, altho i'm not sure man u can win 2-0 against this team. anyhoooooo - it's well worth waking up to watch! also anyone notice the yanks' starting rotation going 15-0 after taking the world champ angels today? just had to mention it... cause i can feel a title run this year!

for those keeping track.. sars has just claimed another 6 people in hk - bring the total to 105. another 23 got infected, but it does seem that more and more people are recovering from the illness.

since no one could tell me if the iraq war was over... i decided to look myself. 'lo n behold, it's not even on the front page of cnn (as of april 22 8pm). well - off on iraq and on in north korea. man - the funny thing bout the korean crisis is how the south koreans are so quick to dismiss the 'axis of evil' threat and criticize america for sending its army all over the world to supposedly keep the rest of the world safe from the 'axis of evil' (n.korea being one of those). new prez. roh is not known for his pro-u.s. stance, and being the dumbass he is, starts voicing his disapproval of the u.s. presence in s.korea (and iraq, for that matter). so then, the u.s. says - ok - we'll just send our troops back off the dmz, some 30,000+ u.s. troopers kept at the 38th parallel to keep the north at bay. then the north again test some nukes n roh is like.. uh well... no - i no want to trouble your troops.. why don't u just keep them there for now???? i tell you - that guy has a long ways to go to realize what the u.s. is doing for his country. better to just clamp down on his cronies at sk group than to mouth off at the country that's keeping them safe.. i mean, who went to war with and for them when the north invaded in the 50s???? but then again - whatevers... politics sometimes pisses me off. like france thinking it is imperative that they have a part in rebuilding and governing (temporarily) the new iraq. idiots. they just wanna win oil contracts for total elf. well - the party's currently in beijing, with china as the mediator (go figure).... wonder if they wearing masks?

so weird... just read in the papers that singapore is now 'tagging' it's quarantined citizened suspected of having sars. and then, as if that wasn't bad enuf, they have installed webcams in 471 households (so far) to monitor the quarantined. they say it's mostly off, and that u only turn it on when the authorities call in and check on you to make sure u home... gotta love them singaporeans! so far, spore has 15 deaths, 160 hospitalized and like 620 quarantined.

today, another 5 in HK died... that brings the total now to 99 deaths here, and so far 1,434 infected... AND.. we have NO quarantines!

why all the news on sars? dunno. what else is there besides that? my dai-so (big sis-in-law - for u non-hongkies) even virtually moved to japan (check my guestmap eh?)...

easter weekend! had a great time at the beach on sunday. it's awesome to be able to witness and pray for people as they make their public declaration of their commitment to god... 8 on sunday at the beach. man, why couldn't i have been baptized at the beach? i was baptized feb 6, 2000 at the jakarta int'l baptist church (jibc, as they like to be called), in a tub that was set behind the altar... not quite the same, eh? now that was a day for new beginnings---stay tuned for pics, when i get my lazy butt on it.

so... seeing as how sars claimed something like 15 lives this past weekend, i can help but hope and pray that somehow this thing will come to some end, and soon! everything in hk is suffering, people, biznass, more people around the world... on the other hand, i can't help but know that god is in control of this situation and that if we continue to live in fear of this, our mission this life will never be accomplish. i'm not saying that one should just recklessly go out n seek out a sniffling, sneezing, coughing person and offer him/her some nyquil (the nitetime, sniffling, sneezing, coughing, aching, stuffy head, fever so you can rest and have a good morning medicine). i still wear a mask most of the time round public transports, but round the streets-it's a crapshoot. it's freeeeeeeeaaaaakkkyyyyy.. but i give you this to think about... when apostles peter & john just got out of prison, they were made fully aware of what would happen to them if they continued preaching. in the face of persecution, danger, and even death, they didn't pray for protection, but rather for god to "... look on their threats, and grant to your servants that with all boldness they may speak your word" (acts 4:29).

sunday nite i actually ventured out to a movie... johnny english. i was a bit hesitant, but i needed to just be out after just a week of some real weird happenings which a stooopid webpage don't need to hear. anyway, bordering on feeling a bit weirded, down, but not too out, and just confoooosed, i ventured out to see the most mind numbing silly movie. i tell you... that mr. bean sure can act! the theater was more than 1/3 full, a bit better than when i saw the recruit on opening w/end, which didn't have more than 20.... sars... pfffftttt

so tonite, i read that another 6 dead and 22 new cases. so much news has been made about china's gaffe over this. it was also made public that the places tung chee hwa (the chief exec of hk) and cabinet all separately visited and 'helped' out with the cleaning efforts and show 'support' for the community... it all turned out to be a farce.. all staged events where, for example, piles of trash were prestacked for anthony leung kum-chung (the crooked finance sec) to sweep up. man... the hk gov't is such a pathetic joke. i guarantee that i can take me and a group of my classmates from b-school and we can run this place better. you listening HO?

anyhoo.. enuf rambling.. i'll save it for another day..

by the way, can someone tell me if the iraq war is over yet?

spent almost the whole day working on this... but i'm glad it's done. you wouldn't believe how much time i spent on this. not even like it was bad time. amazing how i've come to appreciate learning just for the sake of learning now that i don't have to worry about school (for the rest of my life)! where were these kinda programs when I was in school? it's been a constant fascination i have with how younger folk take so easily to this.... like derek... he's my only buddy on here right now :( keep em coming pleeeaaaazzzzeee

just in the news 2day... just to keep track, another 4 people in HK died today from SARS, with another 29 new patients. *siggghhh* ..... this is getting tough to swallow. i mean... in the amoy garden housing estate alone there were 321 cases. i don't even wanna start wondering what's going on in china. them political folks sure had a thing going when they decided to name HK as an SAR (as in special administrative region) zone way back when ...

Sigh... my first blog... i've had this acct for soooo long, but been afraid to use it... ever been afraid of your own thoughts? that's what's so freaky bout blogs... so freaky, yet so revealing, and now for the world to see! oh wells.. and awwwwaaaayyyyyy weeeee gooooooooooooooooooooooooooooo