this is very exciting stuff... they actually decoded the dna of the sars virus.. canada's genome sciences center did it - hey - them canucks are good for something after all... worthy to be the 51st state!!!!! heheeh here's a sample of the download:

CTACCCAGGAAAAGCCAACCAACCTCGATCTCTTGTAGATCTGTTCTCTA
AACGAACTTTAAAATCTGTGTAGCTGTCGCTCGGCTGCATGCCTAGTGCA
CCTACGCAGTATAAACAATAATAAATTTTACTGTCGTTGACAAGAAACGA
GTAACTCGTCCCTCTTCTGCAGACTGCTTACGGTTTCGTCCGTGTTGCAG
TCGATCATCAGCATACCTAGGTTTCGTCCGGGTGTGACCGAAAGGTAAGA

i dunno... i only see blonde, brunette, silky straight black tied up in a bun, a new 983k titleist driver... let's play a game... what words can u make out of these letters? tag, gat (an actual word), at, cat... gattaca? hehe now u know where the movie name came from. anyway - amazing how they can make sense of this; the whole string looks like the matrix. so - anyone remember mgmt274a - that was biotech for u forgetful fools... get on it n figure out the cure! that means YOU, kwon...